ID: 961022745_961022748

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 961022745 961022748
Species Human (GRCh38) Human (GRCh38)
Location 3:123522956-123522978 3:123522996-123523018
Sequence CCTCATCTGAATGATGGGGGTAA TCACCATGATACCACGTTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 159, 4: 1218} {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!