ID: 961302134_961302140

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 961302134 961302140
Species Human (GRCh38) Human (GRCh38)
Location 3:125929120-125929142 3:125929172-125929194
Sequence CCTGGAGACCAAACGCAGGATAA CAGAACAGTAATACGCTAGCAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 7, 3: 10, 4: 122} {0: 9, 1: 4, 2: 1, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!