ID: 961302325_961302328

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 961302325 961302328
Species Human (GRCh38) Human (GRCh38)
Location 3:125930264-125930286 3:125930278-125930300
Sequence CCTGATCACTTCCTAAACTGCAG AAACTGCAGCCCGGCCCACCTGG
Strand - +
Off-target summary {0: 8, 1: 2, 2: 2, 3: 11, 4: 141} {0: 7, 1: 6, 2: 0, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!