ID: 961314512_961314522

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 961314512 961314522
Species Human (GRCh38) Human (GRCh38)
Location 3:126025541-126025563 3:126025572-126025594
Sequence CCTAACCCACATGTTGAAATCCT AGGTGAGGAGGTGGCGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 71, 3: 1089, 4: 13547} {0: 1, 1: 0, 2: 2, 3: 47, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!