ID: 961355999_961356005

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 961355999 961356005
Species Human (GRCh38) Human (GRCh38)
Location 3:126340382-126340404 3:126340410-126340432
Sequence CCAGTCCTGTGGAGCCAAGGGGC AGGAGCAACAAGAGCGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187} {0: 1, 1: 0, 2: 0, 3: 37, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!