ID: 961435332_961435339

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 961435332 961435339
Species Human (GRCh38) Human (GRCh38)
Location 3:126912750-126912772 3:126912781-126912803
Sequence CCTTCCACATTTACCTCCCAGTC TCTGAGGCCACGATGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 357} {0: 1, 1: 0, 2: 0, 3: 20, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!