ID: 961543895_961543903

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 961543895 961543903
Species Human (GRCh38) Human (GRCh38)
Location 3:127618785-127618807 3:127618823-127618845
Sequence CCATAATTAATTTTTAAGACTAT TTGTGGAGATGAGCCCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 700} {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!