ID: 961561161_961561172

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 961561161 961561172
Species Human (GRCh38) Human (GRCh38)
Location 3:127731263-127731285 3:127731308-127731330
Sequence CCTGCCTCAACCTCCCAAGTACT ATGCCTGGCTGCTCTCTTGGTGG
Strand - +
Off-target summary {0: 4, 1: 229, 2: 6098, 3: 94427, 4: 199014} {0: 1, 1: 0, 2: 1, 3: 21, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!