ID: 961664574_961664590

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 961664574 961664590
Species Human (GRCh38) Human (GRCh38)
Location 3:128487788-128487810 3:128487840-128487862
Sequence CCCAGGGACAGCACGTCCGGAGG GGTAGAGTGCGCCTCGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94} {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!