ID: 961665014_961665023

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 961665014 961665023
Species Human (GRCh38) Human (GRCh38)
Location 3:128489251-128489273 3:128489270-128489292
Sequence CCCTCGGCTCCGGGGGCGCCCGG CCGGCTGGGCCCAGCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 163} {0: 1, 1: 0, 2: 5, 3: 18, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!