ID: 961679477_961679486

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 961679477 961679486
Species Human (GRCh38) Human (GRCh38)
Location 3:128589518-128589540 3:128589560-128589582
Sequence CCTAAAAACTCCCCCATATTCTG CACCATCCCCTTCCAGCCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!