ID: 961684501_961684510

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 961684501 961684510
Species Human (GRCh38) Human (GRCh38)
Location 3:128620361-128620383 3:128620386-128620408
Sequence CCACAGCAAAGTGCAGGCACCCT GCCCCCTGGAGGATGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 462} {0: 1, 1: 0, 2: 1, 3: 34, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!