ID: 961688122_961688131

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 961688122 961688131
Species Human (GRCh38) Human (GRCh38)
Location 3:128649724-128649746 3:128649772-128649794
Sequence CCTGGAAACATTTAAGCCAAACA AATGAGAAGCAGCAGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203} {0: 1, 1: 0, 2: 8, 3: 81, 4: 748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!