ID: 961724708_961724715

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961724708 961724715
Species Human (GRCh38) Human (GRCh38)
Location 3:128919832-128919854 3:128919867-128919889
Sequence CCCTGGTACCTCTAGGCCTCCAG AAAATCTGCTTTAGGAGTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 159} {0: 1, 1: 0, 2: 4, 3: 32, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!