ID: 961737020_961737023

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 961737020 961737023
Species Human (GRCh38) Human (GRCh38)
Location 3:129008758-129008780 3:129008771-129008793
Sequence CCTCCTAGAGCTGGGGAAGACTC GGGAAGACTCAGGTACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 287} {0: 1, 1: 0, 2: 3, 3: 22, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!