ID: 961797849_961797853

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 961797849 961797853
Species Human (GRCh38) Human (GRCh38)
Location 3:129422575-129422597 3:129422589-129422611
Sequence CCATCCACACCCTGGGCACTCTT GGCACTCTTCCTTATCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 315} {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!