ID: 961819717_961819723

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 961819717 961819723
Species Human (GRCh38) Human (GRCh38)
Location 3:129569771-129569793 3:129569807-129569829
Sequence CCAATCTTCAGAGGGGCTGGGGC TGCCCTCCAAGGTGTCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 223} {0: 1, 1: 0, 2: 2, 3: 36, 4: 1036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!