ID: 961823467_961823468

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 961823467 961823468
Species Human (GRCh38) Human (GRCh38)
Location 3:129586884-129586906 3:129586897-129586919
Sequence CCTTGATGCTTCTGCCTCTGCTG GCCTCTGCTGTGCCCCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 566} {0: 1, 1: 0, 2: 4, 3: 53, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!