ID: 961887238_961887244

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 961887238 961887244
Species Human (GRCh38) Human (GRCh38)
Location 3:130104233-130104255 3:130104275-130104297
Sequence CCAGGCCTGTGGTACCGTGGGAG AGTGTGACCGAGCCTTCCGAGGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 4, 3: 7, 4: 138} {0: 1, 1: 3, 2: 7, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!