ID: 961958431_961958437

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 961958431 961958437
Species Human (GRCh38) Human (GRCh38)
Location 3:130828288-130828310 3:130828304-130828326
Sequence CCCACAGTCTCAGCCCTGCTCAC TGCTCACTGGTGTGAAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 340} {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!