ID: 962134803_962134816

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 962134803 962134816
Species Human (GRCh38) Human (GRCh38)
Location 3:132722376-132722398 3:132722406-132722428
Sequence CCTAGTGAGTACCAGCAGGACTG GAACGGAACGGGACGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 243} {0: 1, 1: 1, 2: 2, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!