ID: 962134803_962134821

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 962134803 962134821
Species Human (GRCh38) Human (GRCh38)
Location 3:132722376-132722398 3:132722427-132722449
Sequence CCTAGTGAGTACCAGCAGGACTG GGCAGAGGAACGGAACGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 243} {0: 2, 1: 1, 2: 1, 3: 48, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!