ID: 962254476_962254490

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 962254476 962254490
Species Human (GRCh38) Human (GRCh38)
Location 3:133861011-133861033 3:133861050-133861072
Sequence CCACCAAATCCTCCCCCTCCATC GAGGCTGAACCCTTCCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 870} {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!