ID: 962265872_962265876

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 962265872 962265876
Species Human (GRCh38) Human (GRCh38)
Location 3:133943936-133943958 3:133943983-133944005
Sequence CCTAGCTTACACTAACTGCACAG AAGCCTGGCCTGCCTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 104} {0: 1, 1: 0, 2: 2, 3: 45, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!