ID: 962287915_962287923

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 962287915 962287923
Species Human (GRCh38) Human (GRCh38)
Location 3:134103845-134103867 3:134103892-134103914
Sequence CCCAGCTCCATCTTTTCAAAGTG TCCCCTCTAGGCATTAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277} {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!