ID: 962343099_962343110

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 962343099 962343110
Species Human (GRCh38) Human (GRCh38)
Location 3:134601720-134601742 3:134601758-134601780
Sequence CCCCTTTTGCTCGAGGCCGCCGG GCACCCTTGTGAGCTGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26} {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!