ID: 962374532_962374535

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 962374532 962374535
Species Human (GRCh38) Human (GRCh38)
Location 3:134849371-134849393 3:134849392-134849414
Sequence CCAAGAGGACTTCATGGAGAAGA GAGTCCTTTTGGCTTTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 347} {0: 1, 1: 0, 2: 2, 3: 29, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!