ID: 962405204_962405217

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 962405204 962405217
Species Human (GRCh38) Human (GRCh38)
Location 3:135094487-135094509 3:135094523-135094545
Sequence CCTCCTCCACAACTCCTCCCATG ATTCTATTCTGAGGCAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 585} {0: 1, 1: 0, 2: 0, 3: 23, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!