ID: 962536912_962536918

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 962536912 962536918
Species Human (GRCh38) Human (GRCh38)
Location 3:136337587-136337609 3:136337626-136337648
Sequence CCTTTTATTCAAGAGTATATAAA CCATATCCACAGAGGGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 495} {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!