ID: 962662081_962662083

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 962662081 962662083
Species Human (GRCh38) Human (GRCh38)
Location 3:137612459-137612481 3:137612475-137612497
Sequence CCGGATCCAGTGTTCTTTAGGAC TTAGGACGCAGCCAATTTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!