ID: 962708559_962708566

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 962708559 962708566
Species Human (GRCh38) Human (GRCh38)
Location 3:138067504-138067526 3:138067525-138067547
Sequence CCCACTCACCCAAAGGTGCCAGC GCTCACCTGAGCCCTGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 128} {0: 1, 1: 0, 2: 3, 3: 46, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!