ID: 962714527_962714544

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 962714527 962714544
Species Human (GRCh38) Human (GRCh38)
Location 3:138115273-138115295 3:138115326-138115348
Sequence CCGCCCCGCTCCCGGGACGAATT ACCGTGGGGTCTCCTGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 55} {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!