ID: 962744853_962744862

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 962744853 962744862
Species Human (GRCh38) Human (GRCh38)
Location 3:138389646-138389668 3:138389689-138389711
Sequence CCTTAGGGAAATAGGAACACCCT TAGTGGGTCCCTTTAACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146} {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!