ID: 962780862_962780865

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 962780862 962780865
Species Human (GRCh38) Human (GRCh38)
Location 3:138715109-138715131 3:138715126-138715148
Sequence CCCTTCTCTATGTGTAGGAAAGA GAAAGAATGAATGGATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230} {0: 1, 1: 0, 2: 24, 3: 229, 4: 1702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!