ID: 962786147_962786151

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962786147 962786151
Species Human (GRCh38) Human (GRCh38)
Location 3:138769871-138769893 3:138769908-138769930
Sequence CCCTACCCATTTTAAAGATAAGA AGAGTTTAAGTAAATTATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 135, 4: 662} {0: 1, 1: 1, 2: 12, 3: 97, 4: 648}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!