ID: 962855873_962855879

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 962855873 962855879
Species Human (GRCh38) Human (GRCh38)
Location 3:139344176-139344198 3:139344203-139344225
Sequence CCGCCGGTTCAGCTCCGAGGCCG GTGACCTTCCGGACTTTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45} {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!