ID: 962882469_962882471

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 962882469 962882471
Species Human (GRCh38) Human (GRCh38)
Location 3:139591321-139591343 3:139591351-139591373
Sequence CCCACGGAATCGCGCTGATTGCT CAGTCTGAGATCAAACTGCAAGG
Strand - +
Off-target summary {0: 18, 1: 502, 2: 1053, 3: 1038, 4: 855} {0: 3663, 1: 1439, 2: 732, 3: 491, 4: 588}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!