ID: 962882470_962882475

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 962882470 962882475
Species Human (GRCh38) Human (GRCh38)
Location 3:139591322-139591344 3:139591368-139591390
Sequence CCACGGAATCGCGCTGATTGCTA GCAAGGCGGCAACGAGGCTCGGG
Strand - +
Off-target summary {0: 18, 1: 494, 2: 1064, 3: 1054, 4: 865} {0: 1, 1: 330, 2: 1210, 3: 1957, 4: 1748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!