ID: 962921357_962921363

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 962921357 962921363
Species Human (GRCh38) Human (GRCh38)
Location 3:139953345-139953367 3:139953384-139953406
Sequence CCCCTGTGACACGCAATTTACTC ATGTTCCCCCTGAACCTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 81, 3: 375, 4: 731} {0: 1, 1: 0, 2: 3, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!