ID: 962921359_962921363

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962921359 962921363
Species Human (GRCh38) Human (GRCh38)
Location 3:139953347-139953369 3:139953384-139953406
Sequence CCTGTGACACGCAATTTACTCAT ATGTTCCCCCTGAACCTCTAGGG
Strand - +
Off-target summary {0: 4, 1: 26, 2: 155, 3: 459, 4: 879} {0: 1, 1: 0, 2: 3, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!