ID: 963030593_963030597

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 963030593 963030597
Species Human (GRCh38) Human (GRCh38)
Location 3:140970953-140970975 3:140970999-140971021
Sequence CCCATTTGGCTTATAAAGACTCG TTAATTCCTTAAAATAAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55} {0: 1, 1: 0, 2: 5, 3: 110, 4: 988}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!