ID: 963038303_963038319

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 963038303 963038319
Species Human (GRCh38) Human (GRCh38)
Location 3:141051151-141051173 3:141051203-141051225
Sequence CCGCCGCCTTGGCACAGGGGCGC AGCTGGTGGCCTCGAGAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!