ID: 963066998_963067002

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 963066998 963067002
Species Human (GRCh38) Human (GRCh38)
Location 3:141271911-141271933 3:141271928-141271950
Sequence CCCAAAGGAGGATGGGTCTGTCG CTGTCGCCACAGAAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77} {0: 1, 1: 0, 2: 2, 3: 9, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!