ID: 963075571_963075577

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 963075571 963075577
Species Human (GRCh38) Human (GRCh38)
Location 3:141343405-141343427 3:141343436-141343458
Sequence CCAGGGAGGTGGGGATTGTCAAC ACAAGGACCCTTGGAGGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 250} {0: 1, 1: 0, 2: 0, 3: 17, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!