ID: 963078779_963078788

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 963078779 963078788
Species Human (GRCh38) Human (GRCh38)
Location 3:141372181-141372203 3:141372199-141372221
Sequence CCTCTGCCCAGTCCCCTTACATT ACATTAGGATGGAGCTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 302} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!