ID: 963154353_963154358

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 963154353 963154358
Species Human (GRCh38) Human (GRCh38)
Location 3:142079639-142079661 3:142079684-142079706
Sequence CCCAAGAGAAAAGAAACAAATAA CCCGGCAGCAGACTTTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 374, 4: 3552} {0: 2, 1: 24, 2: 323, 3: 557, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!