ID: 963155476_963155477

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 963155476 963155477
Species Human (GRCh38) Human (GRCh38)
Location 3:142091565-142091587 3:142091586-142091608
Sequence CCAAAAAAAAAATAAATAAAATA TAAGCTAGACATTTTTATATTGG
Strand - +
Off-target summary {0: 2, 1: 71, 2: 521, 3: 18254, 4: 31816} {0: 1, 1: 0, 2: 1, 3: 15, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!