ID: 963204261_963204263

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 963204261 963204263
Species Human (GRCh38) Human (GRCh38)
Location 3:142616306-142616328 3:142616327-142616349
Sequence CCTTTTCTATAAAGGATAAGGTA TAGAGAAAAAAGAATGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 307} {0: 1, 1: 0, 2: 3, 3: 103, 4: 1073}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!