ID: 963210156_963210164

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 963210156 963210164
Species Human (GRCh38) Human (GRCh38)
Location 3:142680309-142680331 3:142680350-142680372
Sequence CCTGCTTCAGCCTCCCAAAGTGC CCACCATGCCTGGCCAAAACTGG
Strand - +
Off-target summary {0: 2688, 1: 67947, 2: 186014, 3: 237634, 4: 276237} {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!