ID: 963271166_963271175

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 963271166 963271175
Species Human (GRCh38) Human (GRCh38)
Location 3:143287080-143287102 3:143287128-143287150
Sequence CCTCCTTCCTTCTGGTCCCACTT GCGGGGTGCAGAATAACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 59, 4: 555} {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!